"Dan Ferro has taught some of the most
important singers of the 20th Century"
Brian Zeger - The Juilliard School
The Metropolitan Opera

"Intensive study of vocal technique as applied to the literature for active singers"

Prise en charge et résultats après plusieurs greffes d’organes cornéennes et solides provenant d’un donneur infecté par le virus de la rage

Contexte Cet article décrit des transmissions multiples de la rage via un organe infecté provenant d’un seul donneur infecté varices. Le traitement empirique de Milwaukee a été utilisé chez les receveurs. Les patients symptomatiques ont été traités par sédation profonde kétamine, midazolam et phénobarbital, ribavirine, interféron et vaccination active et passive. Les receveurs des greffes de cornée et de foie ne présentaient aucun symptôme Le receveur de la transplantation hépatique avait été vacciné ~ ans avant la transplantation Deux receveurs de rein et de poumon ont développé la rage et sont morts dans les jours suivant la maladie symptomatique. semaines traitées avant sa mort La charge virale du liquide céphalo-rachidien est restée à des niveaux bas constants & lt ;, copies / mL pendant ~ semaines; Après la mort, aucun virus n’a été retrouvé dans les compartiments périphériques du tissu nerveux, du cœur, du foie ou de l’intestin grêle chez ce patient, contrairement aux patients de la même cohorte qui sont décédés précocement. Conclusions Notre rapport comprend: à notre connaissance, le plus long traitement documenté de la rage symptomatique et la première fois que la concentration virale a été mesurée dans le temps et dans différents compartiments corporels. La concentration de virus post-mortem en périphérie était faible, mais il n’y avait aucune preuve de réduction du virus. le cerveau

La rage est une forme aiguë et invariablement mortelle d’encéphalite virale Le virus de la rage, d’au moins les espèces du genre Lyssavirus, de la famille des Rhabdoviridae, est acquis à partir d’animaux infectés par des piqûres, des égratignures et une exposition muqueuse. , la maladie est facilement confondue avec d’autres troubles neurologiques ou psychiatriques. La transmission de la rage par transplantation cornéenne a été décrite au moins A notre connaissance, la transmission par transplantation d’organe solide n’a été signalée qu’une seule fois. Nous rapportons un deuxième événement similaire qui s’est produit des mois plus tard en Allemagne, lorsque des receveurs de cornées ou d’organes solides ont développé la rage. Ces patients ont été traités par un neuroprotecteur et, hypothétiquement, par un neuroprotecteur. , régime antiviral appliqué chez un patient survivant avec la rage à Milwaukee, Wisconsin Parce que non les expériences avec le régime chez d’autres patients étaient alors disponibles, le patient a été traité pendant un cours inhabituellement long de semaines avec une surveillance continue de la charge virale dans le liquide céphalo-rachidien CSF

Patients, matériaux et méthodes

Patients Le donneur d’organes était une femme âgée hospitalisée pour évaluation d’un état mental altéré avec épisodes de léthargie et d’agressivité. Elle avait été vue quelques jours auparavant par un neurologue à cause de maux de tête et consommait de la cocaïne, des amphétamines et de la MDMA. L’examen neurologique, l’IRM cérébrale et l’analyse du liquide céphalo-rachidien n’ont montré aucune anomalie. Au cours de la journée, elle a développé une détresse respiratoire et de la fièvre. Elle a reçu un traitement antibiotique, des catécholamines et un traitement ventilatoire après un arrêt cardiaque soudain. La tomographie informatisée a révélé un œdème cérébral massif Examen d’un échantillon de liquide céphalo-rachidien obtenu quelques jours après le premier échantillon cellules révélées / μL, concentration en protéines de g / L, glycémie en g / L et concentration en lactate de mmol / L Culture de CSF et les échantillons de sang n’ont pas produit de bactéries ou de champignons Les résultats de la réaction en chaîne par polymérase P La mort cérébrale a été confirmée par un examen neurologique ultérieur. La famille du donneur a consenti à une extraction multiorganique. Les antécédents de tous les receveurs d’organes sont résumés dans le tableau.

Procédures de laboratoire Examen histologique suivi de procédures standard Les anticorps ont été testés par immunodosage enzymatique Platelia Rabies II Kit; Les anticorps neutralisant le virus Bio-Rad ont été déterminés par le test rapide d’inhibition de la focalisation fluorescente Heminested reverse-transcription RT PCR utilisé des amorces adaptées d’un protocole publié La séquence génomique complète du virus rabique a été déterminée directement à partir des expectorations du receveur GenBank AYEmpirical Les détails sur le traitement d’un patient qui a survécu à la rage ont été mis à disposition avant la publication par l’Université Willoughby du Wisconsin; Milwaukee Les parents et les patients ont été informés que le traitement était très susceptible d’échouer et qu’il fallait s’attendre à une invalidité grave même en cas de convalescence. Dans tous les cas, le traitement était préféré aux soins palliatifs.

Résultats

Confirmation de laboratoire et chaînes de transmission

Au cours d’une procédure de rétrospection systématique un jour après la transplantation, la similarité des symptômes du receveur avec ceux du donneur a été notifiée. Des observations similaires ont également été confirmées chez les receveurs et des échantillons archivés de paraffine du tronc cérébral du donneur ont été réexaminés par hématoxiline. Coloration à l’éosine En plus des infiltrations périvasculaires massives, déjà observées lors de l’examen initial, des corps de Negri à densité éosine ont été observés dans des cellules ganglionnaires. La microscopie électronique de sections de diverses régions cérébrales a montré des particules virales avec une morphologie typique de rhabdovirus. Aucun résultat positif à la RT-PCR n’a été observé pour les prélèvements de salive et de biopsie cutanée obtenus chez les receveurs et, ainsi que pour les prélèvements de salive et d’écouvillon cornéen obtenus chez le receveur. dans le lavage broncho-alvéolaire, les expectorations et les sécrétions bronchiques échantillons de retion obtenus du receveur; dans des échantillons de salive provenant du receveur; par RT-PCR nichée adaptée Toutes les séquences de produits de PCR étaient en% identiques, ce qui prouve que la transmission du virus a été isolée dans des cultures cellulaires pour les receveurs et que la comparaison phylogénétique avec La base de données archivistique des Centers for Disease Control and Prevention a révélé une homologie plus proche% nucléocapside identité nucléotidique avec un virus rabique d’un patient américain mordu par un chien en Inde Pendant ce temps, l’histoire de voyage du donneur avait été reconstruit plus précisément observation: un compagnon de voyage qui n’avait pas été disponible pour des interviews avant de se rappeler que le donneur avait été mordu par un chien errant en Inde

Figure Vue largeDétection de la pathologie et de la radiologie A-C, Résultats dans des coupes de tronc cérébral du donneur d’organes A, Corps de Negri rouges dans du tissu paraffinique formel et coloré avec des hématoxilines et des virions de l’éosine B, en microscopie électronique sur cerveau déparaffiné sections traitées avec de l’acide phosphotungstique; C, Coloration fluorescente directe de l’antigène du virus rabique dans le cerveau déparaffinique fixé par acétone par des anticorps monoclonaux marqués à la fluorescéine et isothiocyanatés contre la nucléoprotéine D et E du virus rabique, Résultats en imagerie par résonance magnétique pondérée T chez le receveur une semaine après confirmation en laboratoire de la rage D; pas de résultats significatifs et semaines après le diagnostic confirmé de la rage E; A-C, Constatations dans les coupes du tronc cérébral du donneur d’organes A, corps de Negri rouges dans du tissu paraffinisé, formolés et colorés avec des colorations de substance grise et de ganglions lymphatiques. l’hématoxiline et l’éosine B, s virions bourgeonnant de la rage, comme on le voit en microscopie électronique sur des coupes de cerveau déparaffinées traitées avec de l’acide phosphotungstique; C, Coloration fluorescente directe de l’antigène du virus rabique dans le cerveau déparaffinique fixé par acétone par des anticorps monoclonaux marqués à la fluorescéine et isothiocyanatés contre la nucléoprotéine D et E du virus rabique, Résultats en imagerie par résonance magnétique pondérée T chez le receveur une semaine après confirmation en laboratoire de la rage D; pas de résultats significatifs et semaines après le diagnostic confirmé de la rage E; hyperintensité de substance grise, changement de signal des ganglions de la base et des noyaux sous-thalamiques, et gonflement général du cortex

Cours cliniques après le diagnostic

Tous les receveurs ont été contactés immédiatement lorsque les résultats du donneur ont été communiqués le lendemain de la transplantation. La prophylaxie post-exposition a débuté immédiatement pour tous les receveurs, comprenant une dose unique d’UI / kg d’hyper-immunoglobuline humaine HRIG antirabique; Berirab; Behring et IU du vaccin purifié à base de cellules embryonnaires de poulet PCECV; Rabipur, Behring par voie intramusculaire après,,, et jours Après l’achèvement de la PEP, les receveurs et les titres d’anticorps spécifiques du virus rabique et IU / mL, respectivement, ont été retirés et remplacés chez les deux receveurs. résultats pour les cornées enlevées Les deux patients n’avaient pas développé de symptômes à dateRecipient destinataire était asymptomatique quand il a reçu PEP Étonnamment, les anticorps neutralisant les virus étaient déjà détectables à UI / mL dans un échantillon de sang prétransplantation archivé Les titres de neutralisation ont augmenté à,, et & gt; IU / mL les jours, et, respectivement, Sa mère a rappelé qu’il avait été vacciné contre la rage pendant l’enfance, il y a ~ ans ribavirine mg / jour et interféron pégylé-α-b μg par semaine a été administré malgré ces résultats en raison de la La ribavirine et l’interféron ont été arrêtés, et une thérapie immunosuppressive à haut dosage à court terme a été initiée. Les taux d’enzymes hépatiques sont redevenus normaux en quelques jours. Le patient est en bonne santé à ce jour. Récipiendaire du récipiendaire avait déjà reçu la PPE un jour sur la base d’une suspicion clinique de rage, et une dose supplémentaire de UI / kg de HRIG était administrée le jour. Une sédation profonde était induite par la kétamine – mg / h et midazolam – mg / h Un traitement antiviral était initié avec l’interféron. -α à Mio IE dose sous-cutanée et intraveineuse de charge ribavirine, mg Le jour après la transplantation, le patient a développé un bloc auriculo-ventriculaire et a reçu un Il est mort d’un arrêt cardiaque quelques jours plus tard sans jamais développer d’anticorps neutralisant le virus détectables par immunodosage ou test de neutralisation. Destinataire s Récipiendaire débuté PEP sur la base d’une suspicion clinique suspectée le lendemain de la transplantation Après confirmation en laboratoire, une vaccination passive supplémentaire a été administrée à UI / kg de HRIG par jour jusqu’au jour La ribavirine a été administrée à – mg / kg toutes les heures après une dose de charge initiale de mg / kg. Interféron-α ,, UI a été administré par voie sous-cutanée tous les deux jours Amantadine mg par jour a été ajouté le jour. Les anticorps dirigés contre le virus de la rage n’ont pas été détectés par immunodosage enzymatique dans des échantillons sériques prélevés le jour, et après la transplantation.Récipient Récipient aggravé par des crises de panique, hypersalivation et détresse respiratoire du jour après la transplantation nécessitant des soins intensifs. Figure Anti-thymo La sédimentation profonde a été induite par le midazolam – mg par heure à partir du jour. La kétamine et le phénobarbital ont été ajoutés respectivement à – mg par heure et – mg par heure, ce qui a produit une sédation complète. EEG En plus de la PEP conventionnelle, HRIG a été continué après la première dose à UI / kg par jour Un traitement antiviral a été commencé le jour avec de la ribavirine mg / kg fois par jour pendant plusieurs jours et ensuite mg / kg chaque h Interféron-α a été administré par voie sous-cutanée à μg de Pegasys; Chiron un jour après la transplantation, IU Roferon; On a administré UI tous les jours à partir du jour. Amantadine – mg par heure a été ajouté le jour. La concentration de l’ARN du virus dans le LCR était de 1 copies / mL. Le virus était indétectable dans un échantillon rétrospectif de LCR une semaine plus tôt. les données des autres patients n’étaient pas disponibles dans la littérature, les charges virales ont été déterminées dans les échantillons de LCR stockés des receveurs et des jours et après la transplantation, respectivement, quelques jours avant la mort de chaque patient. Un avantage pronostique a donc été supposé pour le receveur, soutenant les décisions de continuer le traitement. Le nombre de lymphocytes T à ce moment était de cellules / μL, avec un nombre de cellules CD / μL Le niveau de titrage des anticorps neutralisant le jour était de IU / mL, augmentant à IU / mL jours plus tard Pour sonder une éventuelle réponse immunitaire naturelle, HRIG a été interrompu. Cependant, les jours et, aucune augmentation supplémentaire du titre de neutralisation n’a été observée et IU / m L, respectivement Figure, et l’immunisation passive a été réinitialisée le jour avec HRIG UI / kg tous les jours

Figure Vue largeDownload slideClinical courses et vue d’ensemble de la thérapie pour les receveurs de greffe de rein, receveur de transplantation cardiaque et pulmonaire, et receveur de greffe de rate et de rein, qui est mort de la rage Bas, la concentration d’ARN viral dans le temps réaction du liquide céphalorachidien Echantillon du liquide céphalo-rachidien prélevé chez le receveur Le test a utilisé des oligonucléotides AGAAGGGAATTGGGCTTTGAC, AGATGCATGCTCGGGAACA et FAM-ATGGGGTCCCTCGTCAGTTCCATT-TAMRA dans le gène de la nucléocapside AY. La limite de détection a été caractérisée par analyse probit sur ARNc transcrit in vitro, avec des copies d’ARN / mL de CSF détectable à une probabilité de>% HRIG, hyper-immunoglobuline humaine anti-rabique View largeTéléchargement de diapositives et aperçu du traitement pour les receveurs de greffe de rein, receveur de greffe de coeur et de poumon et receveur de greffe de rate et de rein décédé de la rage. , Concentration d’ARN viral Le test a utilisé des oligonucléotides AGAAGGGAATTGGGCTTTGAC, AGATGCATGCTCGGGAACA et FAM-ATGGGGTCCCTCGTCAGTTCCATT-TAMRA dans le gène de la nucléocapside AY. La limite de détection a été caractérisée par analyse de l’ARNc transcrit in vitro, avec des copies d’ARN / mL de CSF détectables à une probabilité de% HRIG, hyper-immunoglobuline humaine antirabique. En raison de la faible pénétration de la ribavirine dans le système nerveux central, la ribavirine a été administrée par voie intrathécale. mg par jour sur jours – et à mg par jour les jours,,,, et Pour fournir une protection potentielle contre les effets indésirables graves de la ribavirine pendant un traitement à forte dose , coenzyme Q, N-acétylcystéine g par jour, acide ascorbique g par jour, et on a ajouté du tocophérol par jour. L’interféron α a également été administré par voie intrathécale à de l’arythmie ont été traités avec des catécholamines et un stimulateur cardiaque temporaire Midazolam et le phénobarbital ont été interrompus en raison d’épisodes de suppression prolongée notés par EEG les jours et, respectivement, la ribavirine a été interrompue les jours et après la journée en raison d’une élévation des niveaux d’enzymes hépatiques. La numération lymphocytaire sur le jour était seulement marginalement améliorée, aux cellules / μL nombre de cellules CD, cellules / μL Les niveaux de titrage du virus sont restés constants à – IU / mL dans les déterminations suivantes réalisées pendant les jours -Après des semaines de thérapie, le patient développait un diabète insipide Les fonctions hypophysaires, thyroïdiennes et surrénaliennes étaient perturbées depuis le jour, nécessitant une désmopressine à μg par jour en moyenne jusqu’à la fin du traitement. Hypothermie observée pendant la quatrième semaine Jusqu’au cinquième jour après la transplantation, lorsque la kétamine devait être arrêtée En raison d’une suppression excessive de l’EEG, seule une augmentation très lente de la charge virale du LCR a été observée. fr Une valeur de copies / mL n’a jamais été dépassée jusqu’à présent. L’IRM n’a révélé qu’une très légère amélioration des ganglions de la base et du putamen. Aucun résultat anormal n’a été observé dans la cytologie et la microscopie du LCR au début de la sixième semaine. L’IRM a révélé une hyperintensité dans la substance grise et un changement de signal dans les ganglions de la base et les noyaux sous-thalamiques. Un gonflement général du cortex était également évident. L’IRM montrait une aggravation des lésions avec augmentation de l’œdème et du gonflement. pléocytose forte, avec des cellules de type macrophage contenant des noyaux pycnotiques La charge virale a augmenté de & gt; intervalles de notation, atteignant une valeur maximale de × copies / mL de LCR Figure Le nombre de lymphocytes dans le sang avait augmenté aux cellules / μL dans une détermination de jour, avec un nombre de cellules CD / μL EEG ne récupérait pas lorsque la sédation était interrompue le jour Un EEG et un test d’apnée indiquent une mort cérébrale un jour après la transplantation, quelques jours après le début de l’hydrophobie comme premier symptôme enregistré de l’infection. Toutes les mesures thérapeutiques et de soutien ont été abandonnées. arrêt a eu lieu le même jour Tableau fournit des concentrations de virus dans les organes post-mortem sélectionnés des receveurs de greffe –

Vue de table grandDownload slideVirus Concentration dans Selected OrgansTable View largeTélécharger slideVirus Concentration dans des organes sélectionnés

Discussion

s ont contenu le virus rabique immédiatement après le don parce que le virus est sécrété dans les glandes lacrymales Sa concentration peut avoir été réduite pendant la culture subséquente dans laquelle les tissus ont été conservés pendant plus de h, comme d’habitude en Allemagne. des virus, également présents à des niveaux faibles ou indétectables dans les cornées précultivées, forment des donneurs virémiques. Trois de nos receveurs d’organes sont morts en dépit des efforts maximaux Un patient a subi le traitement le plus long documenté de la rage. Des collègues de l’Université du Wisconsin avant la publication Il impliquait la kétamine en raison de son effet inhibiteur hypothétique sur la transcription de l’ARN et la fonction N-méthyl D-aspartate NMDA-antagoniste qui pourrait limiter la propagation virale dans les tissus L’amantadine et la ribavirine La disponibilité précoce de ce protocole était un facteur important dans les décisions cliniques. En revanche, nos patients manquaient de facteurs significatifs favorisant de bons résultats qui étaient présents dans le cas traité au Wisconsin. Ce patient a souffert d’un déficit en ARN du virus indétectable dans le LCR. était une jeune fille en bonne santé et diagnostiquée à un stade très précoce des symptômes Des anticorps étaient déjà présents au diagnostic initial, contrairement à nos patients avec une maladie sous-jacente et une forte immunosuppression thérapeutique. En outre, la pathogenèse du virus de la rage des chauves-souris Certains virus de chauves-souris semblent se répliquer in vitro à une certaine efficacité dans des cellules hors du système nerveux central telles que les fibroblastes , ce qui pourrait favoriser in vivo un système immunitaire naturel plus efficace. réponse à travers la présentation de l’antigène L’implication potentielle du passage du sang dans la pathogenèse de l’argent L’infection par le virus de la rage des chauves-souris pourrait accroître l’efficacité de la réponse immunitaire. Le cas du Wisconsin aurait donc été dans une condition particulièrement favorable pour le succès des traitements intensifs invasifs.Parce que nous n’attendions pas de réponse immunitaire naturelle efficace chez nos patients. inclus dans notre régime de traitement modifié Traitement prolongé également impliqué la fourniture de l’interféron alpha et des substances avec une activité antivirale hypothétique dans le LCR Il convient de noter que la PCR en temps réel n’a montré aucune augmentation de la concentration virale dans le LCR sur & gt; semaines La charge virale semble augmenter seulement après l’arrêt de la kétamine Cependant, la prudence est nécessaire pour interpréter cette découverte. Des données expérimentales plus récentes n’ont pu confirmer aucun effet protecteur de la kétamine sur les cellules neurales de la souris infectées par le virus rabique. une extension des épisodes de suppression dans EEG, qui à son tour peut avoir été causée par neurotoxicité virale ou par des phénomènes à médiation immunitaire changements dans l’IRM, l’apparition soudaine de CSF trouble, et le fait que la charge virale CSF une lyse du tissu cérébral induite par l’immunité ainsi qu’une rupture de la barrière cerveau-CSF. La réponse des anticorps était faible et ne semblait pas corrélée avec les changements cliniques, et elle n’était donc pas susceptible d’avoir causé une lyse. la charge virale est allée de pair avec une reconstitution claire de la numération lymphocytaire, et des cellules de type macrophage sont apparues dans le LCR. En effet, des données expérimentales suggèrent que la dégénérescence neuronale primaire est causée par le virus, mais que les cellules T sont ensuite recrutées dans le tissu neural et provoquent une forte dégénérescence secondaire . Le modèle de souris, la clairance virale et la survie dépendent de la présence d’un niveau suffisant d’anticorps neutralisant le virus et d’une réaction inflammatoire cellulaire assez tôt durant l’infection Il est intéressant de noter que chez le receveur, aucun ARN viral n’a pu être détecté en postmortem. Ceci était contraire aux résultats chez les receveurs et, chez qui le virus a été détecté à des concentrations élevées dans les nerfs périphériques et les organes, compatible avec la propagation centrifuge dans la phase symptomatique. Il semble possible que la réponse immunitaire – ou, moins probable, traitement – peut avoir influencé le virus à la périphérie, alors que le compartiment nerveux central Cependant, nous n’avons aucun moyen de vérifier cette hypothèse. Une autre explication possible serait une stagnation de la propagation du virus centrifuge après une longue période de maladie. Ce rapport, ainsi que des observations plus récentes chez d’autres patients, atténuent les attentes concernant l’intervention thérapeutique. Des recherches plus fondamentales menant à de nouvelles immunothérapies ou médicaments antiviraux sont nécessaires de toute urgence

Remerciements

Nous sommes reconnaissants à Rodney Willoughby, Collège médical du Wisconsin, pour ses conseils et son aide en matière de protocoles de traitement. Nous remercions les personnes suivantes pour leurs suggestions et leurs suggestions utiles: Eberhard Weihe, Marburg; Eberhard Walters, Marburg; Siegfried Biehn, Marburg L’Institut Bernhard Nocht agit pour le ministère allemand de la Santé en tant que Centre national de référence pour les maladies infectieuses importées Le Département de virologie de l’Université d’Essen agit en tant que laboratoire consulaire pour la lutte contre la rage. auteurs: pas de conflits