"Dan Ferro has taught some of the most
important singers of the 20th Century"
Brian Zeger - The Juilliard School
The Metropolitan Opera

"Intensive study of vocal technique as applied to the literature for active singers"

Dissémination généralisée en Angleterre d’une variante stable et persistante du virus de l’hépatite B

Contexte Les épidémies d’hépatite B aiguë parmi les détenus dans les régions du nord de l’Angleterre se sont révélées être associées à un seul variant du VHB du virus de l’hépatite B, qui a été porté par les patients Nous avons initié une étude des cas d’hépatite B aiguë Un essai d’électrophorèse sur gel à gradient de dénaturation a été optimisé pour détecter le variant du VHB, et des cas d’infection aiguë par le VHB dans des régions d’Angleterre ont été examinés pour déterminer sa présence. Exemples d’incidents de transmission du VHB reçus La variante a été identifiée en% des cas d’hépatite aiguë examinés dans des régions représentatives en Angleterre. Dans North Humberside, mais pas dans le sud-est de l’Angleterre ni dans les West Midlands, une tendance vers une augmentation de la prévalence du variant a été observée. En outre, la même variante a été identifiée dans le cas des patients ou des patients La propagation de la variante était principalement associée à l’utilisation de drogues injectables. Conclusions La découverte d’un seul variant génétiquement identique sur le bp séquencé occupant une grande niche parmi les virus circulants était inattendue. La découverte a des implications majeures pour l’utilisation de l’analyse de séquençage de l’ADN dans l’étude des chaînes de transmission. L’étude souligne également le besoin d’une meilleure protection des groupes à risque par la vaccination contre le VHB, une stratégie qui atteint actuellement une couverture médiocre.

La Grande-Bretagne a adopté une politique de vaccination sélective plutôt que universelle contre le VHB du virus de l’hépatite B et des épidémies d’hépatite B aiguë continuent de se produire. Couverture vaccinale des groupes à risque, notamment les personnes ayant de multiples partenaires sexuels, les détenus et Les utilisateurs de drogues injectables sont pauvres L’épidémiologie moléculaire des souches de VHB associées à ces éclosions a été étudiée, mais les résultats se sont limités aux cas d’éclosions signalées dans les établissements et les collectivités locales Les enquêtes n’ont pas réussi éclosions survenant dans des régions plus larges Nous décrivons ici la circulation généralisée d’un variant particulier du VHB

Matériaux et méthodes

Les échantillons de sérum prélevés chez des détenus atteints d’hépatite B aiguë confirmée sérologiquement dans des prisons de Hull, une prison de Lancaster, une prison de Durham et une prison de Liverpool ont été envoyés au Laboratoire central de santé publique du CPHL [Colindale, Londres] du Service de laboratoire de santé publique maintenant l’Agence de protection de santé pour l’étude moléculaire dans la liaison possible L’apparition de la maladie s’est produite pour tous les patients de Hull, Lancaster et Durham et s’est produite pendant la période – pour les patients de Liverpool Les données sur le séquençage des nucléotides sous-génomiques du VHB ont révélé qu’une très grande majorité des détenus étaient infectés par un seul variant du VHB; c’est-à-dire que la séquence d’ADN était identique sur un fragment de gène S de surface -bp et un fragment de gène C -bp de noyau ci-après, nous désignons cette variante par “HBVPV” pour indiquer “variante de prison”. Les échantillons de sérum prélevés chez des patients atteints d’hépatite B aiguë au cours de la période ont été recueillis dans les laboratoires suivants: les échantillons du CPHL, qui reçoivent des échantillons de patients dans une grande partie de l’Angleterre et du Pays de Galles; en particulier, Londres, les Home Counties, au sud-est de l’Angleterre, et Trent; les échantillons du laboratoire de santé publique de Hull, qui reçoit des échantillons provenant de North Humberside; Les échantillons du laboratoire de santé publique de Birmingham, qui reçoit des échantillons des West Midlands La période – a été choisie parce qu’elle englobait la période pendant laquelle les épidémies ont eu lieu dans les prisons. Des médecins généralistes et d’autres cliniques et institutions ont infection aiguë par le VHB Nous avons sélectionné des échantillons uniquement sur la base d’un résultat positif pour l’anticorps IgM contre l’antigène de l’hépatite B, marqueur de maladie aiguë. Au cours de l’étude, nous n’avons pas étudié d’échantillons consécutifs de patients. Des échantillons sélectionnés par an provenant du laboratoire de sérum du laboratoire et ceux des laboratoires de Hull et de Birmingham proviennent de tous les cas d’hépatite B aiguë diagnostiqués dans les laboratoires. Les échantillons obtenus par le CPHL en et ceux obtenus par le laboratoire de Birmingham n’étaient pas disponibles. pour l’étude Informations sur les risques relatifs aux patients La pénurie d’informations sur les risques fournies par les échantillons de sérum renvoyés au CPHL excluait une analyse similaire pour les cas de CPHL. Amplification de l’ADN des gènes HBV S et C par extraction de l’acide nucléique de μL de sérum a été effectué en utilisant une méthode au thiocyanate de guanidinium-silice Les extraits ont été soumis à une première amplification PCR en volumes -μL contenant U du mélange de polymérases Expand High Fidelity Roche Diagnostics, μM de chaque désoxynucléoside triphosphate, pmol de chaque amorce PCR, et l’extrait d’ADN μL Les amorces S et S ont été utilisées pour l’amplification de premier cycle d’un segment du gène HBV S , et les amorces et R ont été utilisées pour l’amplification d’un segment du gène C. PCR a été réalisée dans les conditions suivantes : dénaturation à ° C pendant min, suivie de cycles de ° C pour s, ° C pour s, et ° C pour s, avec une extension finale à ° C pour min PCR Nested a été fait sous le même c sauf pour l’amplification de l’ADN du gène S, les amorces et R ont été utilisées, et les amorces -E et -B ont été utilisées pour l’amplification de l’ADN. du gène C Dans toutes les expériences de PCR, la possibilité de contamination croisée a été exclue par l’utilisation de mesures appropriées, telles que des échantillons de contrôle négatif, des pointes résistantes aux aérosols et des salles pré et post-PCR séparées. des échantillons provenant des prisons et des échantillons associés aux incidents de transmission, comme détaillé dans le tableau, ont été purifiés et soumis au séquençage d’ADN en utilisant les kits de séquençage ABI Prism ou ABI BigDye DNA et l’ABI ou séquenceur automatisé PE Applied Biosystems The MegAlign programme du paquet Lasergene DNAStar a été utilisé pour créer des alignements multiples et des dendrogrammes, pour la comparaison des séquences

Diapositive des résultats pour les éclosions et les incidents de transmission associés au virus de l’hépatite B «variante de la prison» VPHPPV, -Table Voir grandTélécharger la diapositiveRésumé des constatations pour les éclosions et les incidents de transmission associés au virus de l’hépatite B La variation de séquence des amplicons du gène S et C du HBV, par électrophorèse sur gel à gradient dénaturant DGGE DGGE a été adaptée pour dépister la variation de séquence de l’ADN amplifié des gènes S et C du HBV Pour générer des amplicons adaptés au DGGE La PCR nichée a été remplacée par des amorces de “clamping” riches en GC, pour empêcher les produits de subir une dénaturation complète durant l’électrophorèse. Pour amplifier l’ADN du gène S pour DGGE, les amorces -clamp ‘-CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGATACCACAGACTAGACTCGTGGTGGAC et R ont été utilisées pour amplifier l’ADN du gène C, amorces -E -clamp ‘-CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGGACGAATTCCATTGACCCGTATAAAGAATT Les expériences finales d’optimisation ont été réalisées en utilisant les premiers échantillons reçus du laboratoire de Hull pour lesquels les séquences des gènes S et C du VHB ont été déterminées dans des échantillons. Les séquences des deux fragments étaient identiques à celles du HBVPV. Dans les autres échantillons, une différence de -bp dans le gène S et une différence de -bp dans le gène C ont été trouvées. discrimination entre les produits de PCR, le gel doit posséder un gradient de% -% de dénaturants Un mélange de dénaturant% comprend% d’acrylamide w / v; Protogel, National Diagnostics, × tampon Tris-acétate EDTA,% formamide v / v, et mol / L urée, alors qu’un mélange% -dénaturant comprend% acrylamide, × tampon Tris-acétate-disodium EDTA,% formamide, et mol / L urée Des gels de gradient ont été coulés à l’aide de l’appareil d’électrophorèse Ingeny Phor U Genetic Research Instrumentation Ltd, conformément aux instructions du fabricant. Les produits PCR – μL obtenus avec les amorces “clamping” ont été mélangés avec un volume égal de tampon de chargement Les gels séparés ont été utilisés pour dépister les variations dans les séquences des amplicons du gène S et C du VHB. Les puits aux extrémités et le milieu des gels ont été chargés avec des produits PCR provenant des plasmides construits pour porter le HBVPV S ou Insertions de gène C L’électrophorèse a été réalisée dans un tampon Tris-acétate-disodium EDTA à ° C et à V, pour h les bandes d’ADN ont été visualisées par transillumination UV après coloration avec des échantillons de sérum SYBR Green I Flowgen. ont été considérés comme porteurs du HBVPV si les produits de PCR dérivés des gènes HBV S et C ont migré vers la même position de gel que les bandes HBVPV de référenceRecherche de HBVPVenvahissement des poussées associées au VHB et autres incidents de transmission Le CPHL avait mené des études moléculaires sur éclosions de l’hépatite B depuis Les dossiers des enquêtes faisant appel à l’épidémiologie moléculaire ont été examinés pour déterminer dans quelle mesure le virus de l’hépatite B pourrait être identifié dans les éclosions.

Résultats

HBVPV détenus des prisons du nord de l’Angleterre Tous les échantillons de sérums des détenus des prisons de Hull, Lancaster et Durham et des échantillons des détenus de la prison de Liverpool ont fourni un ADN amplifiable des gènes HBV S et C Séquençage direct du PCR les produits ont montré que des échantillons de Hull, d’échantillons de Lancaster, d’échantillons de Durham, et tous les échantillons de Liverpool [%] d’échantillons portaient le HBV portant les séquences du gène HBVPV S et C. Ces séquences, qui ont été déposées dans GenBank accession nos AY et AY, permettent d’attribuer le HBVPV au génotype A et le sous-type HBsAg de l’antigène de surface prédite de l’hépatite B à la prévalence du HBVPV dans les régions représentatives de l’Angleterre. Deux cent soixante-six échantillons amplifiables d’ADN HBV assemblés à partir du CPHL et des laboratoires de Hull et Birmingham ont été sélectionné par la DGGE pour le transport des séquences géniques S et C du HBVPV La figure montre les résultats représentatifs du DGGE des produits du PCR générés par le VHB Dans la figure, les bandes d’ADN qui ont migré vers la même position que les bandes de HBVPV de référence sont indiquées par des astérisques. Seuls les échantillons de sérum donnant des bandes de type HBVPV à la fois pour le S et On a considéré que les gènes C portaient HBVPV en figure, ces échantillons de sérum correspondent aux voies,,,, -, et pour l’échantillon des voies et, -,,, -,, et pour l’échantillon de la figure illustre le résultat d’une DGGE étude des produits de PCR du gène HBV C dérivés de l’ensemble des échantillons de sérum provenant du laboratoire de Hull. La tendance à l’augmentation du nombre de cas d’hépatite B aiguë et de la proportion d’amplicons porteurs du virus HBVPV C la séquence du gène est clairement évidente: par et, une écrasante majorité des échantillons de sérum portait la séquence du gène HBVPV C

Figure vue grandDownload slide Gels représentatifs obtenus par électrophorèse sur gel gradient dénaturant des produits de PCR générés à partir des gènes S et C du virus de l’hépatite B HBV dans un ensemble d’échantillons de sérum référé au Laboratoire central de santé publique dans et Lane P, référent HBVPV “Les amplicons indiquent des bandes d’ADN qui ont migré vers la même position que les amplicons référentsFigure View largeTélécharger les gels représentatifs obtenus par électrophorèse en gradient de gel dénaturant des produits de PCR générés à partir des gènes S et C du virus de l’hépatite B dans un ensemble d’échantillons de sérum le Laboratoire central de santé publique dans et Lane P, référent HBVPV “variant de prison” amplicons Les astérisques indiquent des bandes d’ADN qui ont migré à la même position que les amplicons référents

Diapositives obtenues par électrophorèse sur gel dénaturant des produits de PCR générés à partir du gène de base du virus de l’hépatite B dans l’ensemble des échantillons de sérum provenant de patients communautaires, et non des détenus de l’hépatite B aigu renvoyés au Laboratoire de santé publique de Hull. Les images obtenues à partir d’astérisques indiquent des bandes d’ADN qui ont migré vers la même position que les amplicons référents. Gels obtenus par électrophorèse en gradient de gel dénaturant des produits de PCR générés à partir du gène du virus de l’hépatite B dans l’ensemble des échantillons de sérum Les détenus de prison avec une hépatite B aiguë qui ont été référés au laboratoire de santé publique de Hull à travers des astérisques indiquent des bandes d’ADN qui ont migré à la même position que les amplicons référents. Les changements dans la proportion d’échantillons de sérum portant HBVPV pour les laboratoires sont résumés proportion d’échantillons transportant H BVPV était significatif pour les échantillons du laboratoire de Hull P & lt; , par le χ test de tendance linéaire mais pas pour les échantillons du laboratoire du CPHL et de Birmingham Bien que les différences entre les laboratoires dans la proportion d’échantillons porteurs du HBVPV ne soient pas significatives pour et, les différences sont significatives pour et P = et P & lt; , respectivement, par le test χ

Figure Vue largeDownload slideDistribution de l’infection par le virus de l’hépatite B “variante prison” HBVPV parmi les cas d’hépatite B aiguë de différentes régions en Angleterre à partir de Numbers dans les cases au sommet de chaque barre indiquent la proportion de cas d’hépatite B aiguë qui sont des cas de l’infection par le HBVPV Des barres blanches, des échantillons du Laboratoire central de santé publique du sud-est de l’Angleterre; barres grises, échantillons du Laboratoire de santé publique de Hull; Les distributions de l’infection par le virus de l’hépatite B “variante de la prison” HBVPV parmi les cas d’hépatite B aiguë de différentes régions en Angleterre à partir de Numbers dans les cases au sommet de chaque barre indiquent la proportion des cas d’hépatite B aiguë qui sont des cas d’infection par le HBVPV Barres blanches, échantillons du Laboratoire central de santé publique du sud-est de l’Angleterre; barres grises, échantillons du Laboratoire de santé publique de Hull; barres noires, échantillons du Laboratoire de santé publique de BirminghamSur le cas des patients de Hull qui étaient infectés par le HBVPV,% étaient des CDI et% avaient des antécédents d’emprisonnement; Aucune information sur le risque n’était disponible pour les autres patients.% Parmi les patients de Birmingham infectés par le HBVPV, les risques associés à l’hépatite B aiguë étaient les suivants: rapports homosexuels masculins, cas%; voyage à l’étranger, patients hospitalisés%; utilisation de drogues injectables, cas patients%; rapports hétérosexuels, cas patients%; traitement médical / injections, cas patients%; HBVPVdans les flambées associées au VHB et autres incidents de transmission De part en part, le CPHL a mené des enquêtes sur les éclosions d’hépatite B et les incidents de transmission dans Au Royaume-Uni, et l’incidence de l’hépatite B aiguë dans chaque groupe variait de – cas Onze% de ces enquêtes ont été des éclosions et des incidents de transmission impliquant HBVPV dans les cas patients ou les émetteurs de l’infection et ont été localisés dans des régions géographiquement disparates. les caractéristiques des poussées et des incidents de transmission associés au HBVPV sont présentées dans le tableau Les transmetteurs de l’infection ont été regroupés dans les groupes suivants: associés à des groupes de transfusions sanguines associés à un groupe de transmission chirurgien-patient et associés à des mères-enfants cluster de transmission Pour les autres clusters c L ‘HBVPV a été identifiée parmi les patients, dans des proportions variables. Analyse phonogénétique Pour mieux caractériser la séquence HBVPV, nous avons effectué une comparaison phylogénétique du gène le plus long du gène S et d’ un autre génotype. Séquences identifiées lors des investigations sur les incidents de transmission et les séquences de génotype A déposées dans GenBank X X, X, M et X La figure de dendrogramme qui en résulte montre plusieurs séquences très voisines présentes dans les échantillons CPHL Séquences South East Health Protection Agency,, -, et X et diffèrent d’un seul nucléotide

Figure Vue largeDownloadrogramme du génotype A virus de l’hépatite B HBV surface S gène Séquences du produit de la PCR La séquence «variant de la prison» du HBVPV a été alignée avec les échantillons South East Health Protection Agency -, provenant des enquêtes sur les incidents de transmission en Angleterre. de GenBank sont identifiés par leurs numéros d’accession X, X, M et XFigure View largeTélécharger le slideDendrogramme du génotype A Virus de l’hépatite B HBV surface S gène Séquences du produit PCR La séquence “prison variant” du HBVPV a été alignée avec les échantillons. , qui proviennent des enquêtes sur les incidents de transmission en Angleterre à partir de Quatre séquences supplémentaires de GenBank sont identifiées par leurs numéros d’accès X, X, M et XF également, une recherche BLAST de la base de données GenBank, en utilisant les séquences de PCR du HBVPV S et C gènes, retourné un grand nombre de séquences identiques ou très similaires de divers études, indiquant que HBVPV est une variante commune dans le monde entier

Discussion

fectionApplication d’un test à haut débit impliquant DGGE d’échantillons de sérum provenant de cas de régions de l’Angleterre qui avaient reçu un diagnostic d’hépatite B aiguë entre et a révélé que HBVPV était répandu dans le pays avant, contemporain et après les flambées dans le La forte prévalence du HBVPV a été confirmée par le fait que% -% des échantillons de sérum du CPHL représentaient principalement des cas d’hépatite B aiguë dans le sud-est de l’Angleterre et% -% des échantillons de sérum du laboratoire de Birmingham reflétant des cas de Bien qu’aucune tendance à l’augmentation de la proportion de HBVPV n’ait été observée pour les échantillons du CPHL et du laboratoire de Birmingham, une tendance notable à une augmentation de la proportion d’échantillons envoyés par le laboratoire de Hull Cette augmentation correspond à l’apparition d’une épidémie d’hépatite B aiguë dans la communauté qui a débuté en chiffres et, impliquant le HBVPV comme cause de l’épidémie L’analyse des risques a montré que l’augmentation des cas associés au HBVPV dans North Humberside était associée à l’emprisonnement et à l’injection de drogues. Les personnes libérées ont tendance à changer fréquemment de partenaires sexuels et à continuer à La question de savoir si l’éclosion d’hépatite B aiguë dans la collectivité était liée aux éclosions dans les prisons de Hull ne peut être officiellement vérifiée, bien que la chronologie des événements et la proportion élevée d’anciens détenus parmi les patients la communauté est compatible avec un tel lien que le HBVPV peut être trouvé dans des sous-populations autres que celles constituées d’UDI et les personnes ayant des antécédents d’emprisonnement sont suggérées dans l’analyse des risques pour les patients infectés par le HBVPV dans les West Midlands. l’homosexualité et l’hétérosexualité, plutôt que l’injection de drogue ou l’emprisonnement, était le principal facteur de risque infection par le VHBPP aiguë L’analyse des éclosions d’infection par le VHB et d’autres incidents de transmission étudiés par le CPHL a également montré que le VHBP pouvait être transporté par diverses personnes autres que celles qui admettaient être des UDI; Néanmoins, la prévalence du HBVPV chez les UDI est restée élevée, comme en témoignent les grappes de cas dans le groupe de Norwich et dans le groupe de Leicester. Le plus grand fragment d’ADN que nous avons étudié comprenait des codons. – du gène HBV S, qui entre parenthèse dans la région hydrophile majeure de HBsAg Les mutations associées à l’échappement du vaccin et aux faibles signaux HBsAg dans les tests sérologiques sont localisées dans ce domaine Nous avons cherché de telles mutations et trouvé que le HBVPV était une variante sauvage. ne pas rechercher de mutations dans le domaine du gène pré-C, dont certaines sont réputées abroger la production de l’antigène HBeAg de l’hépatite B, car les tests sérologiques des détenus infectés par le HBVPV ont montré que les patients portaient HBeAg l’implication du HBVPV dans de nombreuses chaînes d’infection pendant ~ ans, aucun changement de séquence n’a été observé dans les gènes S et C Nous avons trouvé cela surprenant, en particulier parce que ces gènes ont tendance à porter plus de loci hypervariables que d’autres domaines génomiques du VHB L’analyse phylogénétique qui incluait d’autres séquences du génotype A des enquêtes sur les incidents de transmission a révélé plusieurs séquences du gène S étroitement apparentées. les séquences apparentées doivent être considérées comme une famille de variants ou quasi-espèces distincte et dans quelle mesure elles ont pénétré la population de VHB circulante au Royaume-Uni si cette stabilité est spécifique au VHBP ou si elle peut être conférée à tout variant du VHB ayant La niche, par exemple chez les UDI qui favorisent une transmission rapide et continue des hôtes avec une infection aiguë, est inconnue. Une conséquence importante d’une séquence particulière du VHB maintenue sur une longue période malgré la transmission par plusieurs cycles d’infection est que les inférences épidémiologiques sur la causalité et la transmission pourraient être confondues. tests de séquençage i De plus en plus, ils sont utilisés pour établir qu’un variant particulier du VHB est porté par la source d’un groupe de cas d’infection par le VHB et suivre les chaînes de transmission du VHB [, -,, -] Lorsque des séquences subgénomiques identiques ou très similaires sont identifiées, La conclusion est que la transmission récente a eu lieu entre individus infectés. Compte tenu de nos découvertes, l’utilisation du séquençage PCR seul ne peut pas être à l’origine d’un variant du VHB dans les événements de transmission sans une étude des génomes du VHB en circulation. sur d’autres données épidémiologiques soigneusement collectées Lorsque les données épidémiologiques et moléculaires sont corrélées, des informations sur la source et la propagation de l’infection par le VHB peuvent être révélées

Remerciements

Nous remercions les collègues suivants pour avoir fourni des spécimens pour cette étude: A Codd, M Fraser, P Mannion, P Morgan-Capner, J Nash, C Quigley et M Sillis. Nous sommes redevables à P Mortimer pour la lecture critique du manuscrit. Protection Agency, Royaume-UniConflit d’intérêts Tous les auteurs: Pas de conflit